When conducting molecular cloning experiments in the laboratory, it is often necessary to synthesize a large number of primers, and these synthetic primers must first be appropriately diluted before use. If primers are used without dilution, they often result in wasted primers and premature loss of activity, and some are contaminated and cannot be used. Therefore, it is recommended to dilute the synthetic primers before use. The diluted primer is conducive to storage and application.
The method is briefly described as follows:
1. Oligo DNA is calculated in OD260 units, which means that in a 1ml volume 1cm light path standard cuvette, an Oligo solution with an absorbance of 1A260 at a wavelength of 260nm is defined as 1 OD260 unit. At 33μg of Oligo DNA, you can calculate the number of moles based on this data and the molecular weight of your Oligo DNA to calculate solutions with different molar concentrations.
2. The formula for calculating the molecular weight of the primer sequence is as follows:
MW = (A base number × 312) + (C base number × 288) + (G base number × 328) + (T base number × 303) -61
For example: Primer TGGGCGGCGGTTGGTGTTACG A = 1 C = 3 G = 11 T = 6
MW = (1 × 312) + (3 × 328) + (6 × 303) -61 = 6541
3. The molecular weight of Oligo DNA can also be calculated by the following approximate method: the average molecular weight of each deoxynucleotide base in Oligo DNA is approximately 324.5, then the molecular weight of an Oligo DNA = the number of bases × 324.5.
example:
You get a tube of 20 mer Oligo DNA labeled 5 OD260
Molecular weight = 20 × 324.5 = 6490
Mass number = 5 × 33 = 165μg
Molars = 165/6490 = 0.025μmol = 25nmol
If adding 400μl of sterilized double distilled water to dissolve, the concentration is 25nmol / 400μl = 62.5μM
4. Eppendorf tubes with primers are generally stored at -20 ℃ and diluted before use.
5. Because Oligo DNA is attached to the tube wall as a light dry film, it is easily lost when opened, so please centrifuge at 10,000rpm for 1min before opening the tube, and then slowly open the cap.
6. Add 100-500μl of double-distilled water to the eppendorf tube equipped with primers, close the tube cover, shake up and down for 5-10 minutes, and centrifuge again at 10,000rpm for 1min.
7. Calculate the primer concentration of the original primer tube (if necessary, measure OD260 to check whether the amount of primer provided by the manufacturer is correct).
8. Calculate and dilute the primer to 10 pmol / μl.
9. Indicate the original primer tube, application primer tube, and dilution method, and store at -20 ℃.
round coffee table,luxury coffee table,coffee table set luxury modern,stone coffee table
Kumusi (Dongguan) Furniture Co., Ltd. , https://www.coombesfurniture.com